Crystallization of Tma Rex Ternary Complex

DNA cloning, expression, and purification of Tma Rex has been recently described by Park et al. [21 (link)]. The purified Tma Rex was concentrated up to 36 mg mL⁻¹ for crystallization using Centricon YM-10 (Millipore). To obtain crystals of the ternary complex Tma Rex, 22-bp duplex oligonucleotides (5′–ATTTGAGAAATTTATCACAAAA–3′ and 5′–TTTTGTGATAAATTTCTCAAAT–3′) containing a promoter region of the TM0201 gene regulated by Tma Rex were chosen. The oligonucleotides were dissolved in 200 mM NaCl, 1 mM MgCl₂, 20 mM Tris-HCl at pH 8.0, and 5% (v/v) glycerol solution and mixed with Tma Rex at a molar ratio of 1.2:2 (1 oligonucleotide: 1 dimeric protein). Crystallization was performed by the sitting-drop vapor diffusion method at 296 K using 96-well CrystalQuick plates (SWISSCI MRC, UK). Each sitting-drop was prepared by mixing equal volumes (0.75 μL) of the reservoir solution and ternary complex. The ternary complex crystals were obtained by co-crystallization with 1 mM NAD⁺ and were grown in 0.05 M Bis-Tris buffer pH 6.5 and 45% (v/v) polypropylene glycol P400.