TASK-1 G203D Mutant Generation

The TASK-1 G203D point mutation was generated using a previously described approach (28 (link)). The sequences of oligonucleotide primers (Integrated DNA Technologies) used to create the TASK-1 G203D mutant were ACCACCATCGGCTTCGACGACTACGTGGCGCTGCAGA (forward) and TCTGCAGCGCCACGTAGTCGTCGAAGCCGATGGTGGT (reverse). PCRs were performed in 50 µL with Q5 high-fidelity DNA polymerase (New England Biolabs) with 100 ng of pCDNA3.1-KCNK3 plasmid. DNA was then incubated with 1 µL DpnI for two hours at 37 °C. Clones were sequenced to confirm mutagenesis.

Partial Protocol Preview
This section provides a glimpse into the protocol.
The remaining content is hidden due to licensing restrictions, but the full text is available at the following link: Access Free Full Text.

Vierra N.C., Dadi P.K., Milian S.C., Dickerson M.T., Jordan K.L., Gilon P, & Jacobson D.A. (2017). TALK-1 channels control β cell endoplasmic reticulum Ca2+ homeostasis. Science signaling, 10(497), eaan2883.

Publication 2017

oligonucleotide primers Q5 high-fidelity DNA polymerase

Clones Dna polymerase Mutagenesis Oligonucleotide primers Pcrs Plasmid Point mutation

Corresponding Organization : Vanderbilt University

Other organizations : UCLouvain

Top 5 similar protocols

Variable analysis

independent variables

Generation of TASK-1 G203D point mutation

dependent variables

Confirmation of mutagenesis by DNA sequencing

control variables

Use of 100 ng of pCDNA3.1-KCNK3 plasmid
Incubation with 1 µL DpnI for two hours at 37 °C

controls

Positive control: Not explicitly mentioned
Negative control: Not explicitly mentioned

Annotations

Based on most similar protocols

Etiam vel ipsum. Morbi facilisis vestibulum nisl. Praesent cursus laoreet felis. Integer adipiscing pretium orci. Nulla facilisi. Quisque posuere bibendum purus. Nulla quam mauris, cursus eget, convallis ac, molestie non, enim. Aliquam congue. Quisque sagittis nonummy sapien. Proin molestie sem vitae urna. Maecenas lorem.

As authors may omit details in methods from publication, our AI will look for missing critical information across the 5 most similar protocols.

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!