Taxonomic Identification of Microbial Isolates

10 μl of T. muris eggs were dropped onto LB plates (NYU Reagent Preparation Core) and incubated at 37°C overnight. Colonies that grew were then picked and added to Eppendorf tubes containing GoTaq G2 Hot Start Green Master Mix (Promega). DNA was extracted by heating the mixture at 95°C and the 16S rRNA gene was then amplified using 16S-Fwd (CCGATATCTCTAGAAGAGTTTGATCCTGGCTCAG) and 16S-Rev (CCGATATCGGATCCACGGTTACCTTGTTACGACTT) primers in a PCR reaction. PCR product was sent to Macrogen for sequencing and the sequences were aligned to the EzBioCloud 16S rRNA database for initial taxonomic identification [17 (link),53 (link)].