Genetically Engineered C. parvum Luciferase Strains

The 5’ UTR and 3’UTR of the C. parvum actin gene was amplified from parasite genomic DNA and ligated into KpnI/ClaI and SpeI/BamHI sites of plasmid TK-Eno-Nluc-Neo-TK 8 (link) respectively. The coding sequence for red-shifted luciferase20 (link) was amplified from pTubRE9 vector (kind gift from Markus Meissner, University of Glasgow) and cloned into SalI/NheI restriction sites replacing Nluc. A 404 bp fragment of the 5’TK flank, the tk gene and a ribosomal 3’UTR was inserted upstream of the 5’ actin UTR using Gibson Assembly cloning (New England Biolabs). The final vector, along with the Cas9 plasmid containing a TK guide RNA (GAAGAATACAATTTCTAAGG) that targets the 3’ end of the tk gene was used to transfect C. parvum sporozoites. Sporozoites were delivered via surgery into the small intestine of C57BL/6 IFN-γ knockout mice (B6.129S7-Ifngtm1Ts/J, Jackson Laboratories) using procedures described previously8 (link). Note that UGA1 Nluc parasites were generated using C. parvum IOWA II oocysts purchased from Sterling Parasitology Laboratory, University of Arizona whereas the UGA2 Fluc strain was engineered using C. parvum IOWA II oocysts purchased from Bunch Grass Farms, Deary, ID.