SARS-CoV-2 Protein and RNA Detection

RNA extraction from Trizol was performed as described previously(36 (link)), while protein was extracted from the interphase using isopropanol precipitation(37 (link)). Precipitated protein was washed in ethanol, resuspended in 5x SDS-PAGE loading buffer, sonicated for 10 seconds, and boiled for 10 min before 8% SDS-PAGE analysis. Western blot was performed using antibodies directed against IAV HA (Invitrogen, PA5–34929) and NP (GeneTex, GTX125989) and SARS-CoV-2 S (Abcam ab272504) and N (GeneTex, GTX632269). Membranes were washed in TBS containing 0.1% tween-20. Spike RNA was purchased from IDT and had the sequence 5 -AGUAGAAACAAGGCGGUAGGCGCUGUCCUUUAUCCAGACAACCAUUACCUGUCCACACAAUCUGCCCUUUCGAAAGAUCCCAACGAAAAGAGAGACCACAUGGUCCUUCCUGCUUUUGCU-3 . Isolated RNA was reverse transcribed using SuperScript III and a primer binding to the 3′ end of the NA segment (36 (link)). qPCR was performed as described previously (36 (link)). Data was analysed in Graphpad Prism 8 using one-way ANOVA with multiple corrections.