Plasmid Construction for Genome Editing

DNA oligonucleotides were obtained from Integrated DNA Technologies (except where otherwise specified). All mammalian editor plasmids used in this work were cloned by Gibson assembly according to manufacturer’s protocols. Except for the CRISPRi library, plasmids expressing sgRNAs were constructed by ligation of annealed oligonucleotides into BsmBI-digested acceptor vector as previously described^{24 (link),30} . Plasmids expressing pegRNAs were constructed by Golden Gate assembly using a custom acceptor plasmid as previously described^{38 (link)}. Protospacer sequences of sgRNAs used for non-library experiments in this work are listed in Supplementary Table 4. pegRNA protospacer and extension sequences are listed in Supplementary Table 4, tab #3. Vectors for low-throughput mammalian cell experiments were purified using Plasmid Plus Midiprep kits (Qiagen) or PureYield plasmid miniprep kits (Promega), which include endotoxin removal steps. Cloning of the CBE SaCas9 sgRNA for screening was conducted by KLD assembly according to the manufacturer’s protocol using BPK2660 (Addgene #70709) as a template with the following primers (protospacer is bolded): GGTGTTTCGTCCTTTCCACAAGATA, gCTGATAGGCAGCCTGCACTGGGTTTTAGTACTCTGTAATGAAAATTACAGAATCTAC.