Gene Expression Analysis in Mouse Brain

Mice were killed 48 hr after CSDS (see below), brains were removed, coronally sliced and mPFC, vHIP and AMY tissue was rapidly dissected and frozen on dry ice. RNA isolation, qPCR and data analyses were performed as described^{1 (link)}. Briefly, RNA was isolated with TriZol reagent (Invitrogen) and purified with RNAeasy micro kits from Qiagen. All RNA samples were determined to have 260/280 and 260/230 values ≥1.8. Reverse transcription was performed using iScript (BioRad). qPCR using SYBR green (Quanta) was carried out with an Applied Biosystems 7900HT RT PCR system with the following cycle parameters: 2 min at 95°C; 40 cycles of 95°C for 15 s, 59°C for 30 s, 72°C for 33 s; and graded heating to 95°C to generate dissociation curves for confirmation of single PCR products. Data were analyzed by comparing C(t) values of conditions tested (control vs. susceptible or resilient mice) using the ∆∆C(t) method^{42 (link)}. qPCR primers: Egr1 FWD: GAGGAAGTTTGCCAGGAGTG, Egr1 REV: GAGTAGGAAGTGGGCACAGG; Arc FWD: GAAGTGGTGGGAGTTCAAGC, Arc REV: TCCTCAGCGTCCACATACAG.