RT-PCR Analysis of ABCB4 Expression

RNA was isolated using the Isol-RNA lysis procedure (5 Prime, Hamburg, Germany). 25 μg of breast, kidney, liver and lung RNA of normal human samples were obtained from Agilent Technologies (Waldbronn, Germany). RNA was DNase (Fermentas GmbH, St.Leon-Rot, Germany) digested and then reversely transcribed19 (link). RT-PCR was performed with primers: ABCB4RTF1: GCAGACGGTGGCCCTGGTTGG, ABCB4RTR1: TGGAAAACAGCACCGGCTCCTG, ACTFW: CCTTCCTTCCTGGGCATGGAGTC and ACTRV: CGGAGTACTTGCGCTCAGGAGGA. For mouse mABCB4RTF1: CCCTCCAGCCGGCTTTCTCCA, mABCB4RTR1: GGACCGGAGCCTTGTGGTGAGG, mGAPDHRTF1: GCCGCCTGGAGAAACCTGCC and mGAPDHRTF1: CCCCGGCATCGAAGGTGGAA were utilized. Quantitative PCR (qRT-PCR) was performed in triplicates with PerfeCTa SYBR® Green (Quanta BioSciences, Gaithersburg, USA) using Rotor-Gene 3000 (Corbett Research, Qiagen, Hilden, Germany).

Free full text: Click here

Kiehl S., Herkt S.C., Richter A.M., Fuhrmann L., El-Nikhely N., Seeger W., Savai R, & Dammann R.H. (2014). ABCB4 is frequently epigenetically silenced in human cancers and inhibits tumor growth. Scientific Reports, 4, 6899.

Publication 2014

PerfeCTa SYBR® Green

Breast Dnase Gene Human Kidney Liver Lung Mouse Primers Rt pcr Sybr green

Corresponding Organization :

Other organizations : Max Planck Institute for Heart and Lung Research, German Center for Lung Research, University of Giessen

Top 5 similar protocols

Variable analysis

independent variables

RNA isolation method (Isol-RNA lysis procedure)
Source of RNA samples (breast, kidney, liver, lung)
Tissue type (normal human samples)
Primers used for RT-PCR (ABCB4RTF1, ABCB4RTR1, ACTFW, ACTRV, mABCB4RTF1, mABCB4RTR1, mGAPDHRTF1, mGAPDHRTF1)

dependent variables

Gene expression (measured by qRT-PCR)

control variables

DNase digestion of RNA
Reverse transcription
Use of PerfeCTa SYBR® Green for qRT-PCR
Rotor-Gene 3000 instrument for qRT-PCR

controls

Positive control: None specified
Negative control: None specified

Annotations

Based on most similar protocols

Etiam vel ipsum. Morbi facilisis vestibulum nisl. Praesent cursus laoreet felis. Integer adipiscing pretium orci. Nulla facilisi. Quisque posuere bibendum purus. Nulla quam mauris, cursus eget, convallis ac, molestie non, enim. Aliquam congue. Quisque sagittis nonummy sapien. Proin molestie sem vitae urna. Maecenas lorem.

As authors may omit details in methods from publication, our AI will look for missing critical information across the 5 most similar protocols.

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!