Generating Caveolin-1 Knockout Cell Lines

Primer to generate CAV-1 targeting crRNA (AGTGTACGACGCGCACACCA)was synthesized (Integrated DNA Technologies), phosphorylated using PNK kinase (New England Biolabs) and cloned into pSpCas9(BB)-2A Puro (PX459) V2.0 (a gift from Feng Zhang, MIT, Cambridge, MA, USA; Addgene plasmid #62988) [25 (link)] to generate pTJK387. A549 cells were cultured and 105 cells are seeded into 6 well plates and transfected with pTJK387 using Lipofectamine 2000 (ThermoFisher Scientific). After 24 hours, cells were puromycin selected for 48 hours prior to being plated into 96 well plates at a concentration of 0.5 cell/ well to isolate single cell clones. Single cell clones were subsequently expanded and screened by Western Blot assay to identify Caveolin-1 knockout cell lines. The CAV-1 gene expression construct was generated by PCR amplification (CAV1α: GCTAGCCACCATGTCTGGGGGCAAATACG and GTCGACTTATATTTCTTTCTGCAAGTTGATG and cloned into GFP-marked lentivector pWCC43 [26 (link)] using Nhe1-Sal1. All constructs were validated by sequencing. These single cell clones were expanded and harvested. Protein estimation by Western Blot assay was done to confirm the outcome of genome editing (Caveolin-1 knockout) with CRISPR-Cas9 system.