THF RIG-I−/−, MDA5−/− and RIG-I−/−MDA5−/− were generated by lentivirus-mediated CRISPR-Cas9 KO and puromycin selection as described in Hare et al., 2015. FLAG-RIG-I, FLAG-RIG-IK270A and FLAG-RIG-IK888/902A in pEF-Bos plasmid (a kind gift from Michael Gale) were cloned into pLenti-blast via endonuclease digestion and ligation and used to produce lentivirus particles. THF RIG-I−/−MDA5−/− cells were reconstituted with FLAG-RIG-I by transduction and blasticidin selection.
Cell lines expressing p14 under a tetracycline-inducible promoter were generated using a transposon recombination-based PiggyBac vector system [18 (link)]. The cDNA sequence of the p14 FAST protein was amplified by PCR using the forward primer GGGGACAAGTTTGTACAAAAAAGCAGGCTTCACCATGGGGAGTGGACCCTCT and the reverse primer GGGGACCACTTTGTACAAGAAAGCTGGGTCCTAAATGGCTGAGACATTATCGATGTTG. A two-step recombination reaction mediated by BP and LR clonase enzymes integrated the p14 gene into the PB-TAG vector.
Three plasmids, i.e., PB-TAG (encoding the gene of interest), pCYL43 (encoding the PBase recombination enzyme) and PB-CAG rtTA (encoding the rtTA protein which initiates gene expression in the presence of doxycycline) were nucleofected into telomerase life-extended human fibroblasts (THF) [19 (link),20 (link)]. p14-positive cells were selected for with 3 μg/mL of puromycin. THF-p14 STING−/− and THF-p14 RIG-I/MDA5−/− cells were generated in the same manner, but the plasmids were inserted into the corresponding THF knock-out cell type.
Cell lines expressing p14 under a tetracycline-inducible promoter were generated using a transposon recombination-based PiggyBac vector system [18 (link)]. The cDNA sequence of the p14 FAST protein was amplified by PCR using the forward primer GGGGACAAGTTTGTACAAAAAAGCAGGCTTCACCATGGGGAGTGGACCCTCT and the reverse primer GGGGACCACTTTGTACAAGAAAGCTGGGTCCTAAATGGCTGAGACATTATCGATGTTG. A two-step recombination reaction mediated by BP and LR clonase enzymes integrated the p14 gene into the PB-TAG vector.
Three plasmids, i.e., PB-TAG (encoding the gene of interest), pCYL43 (encoding the PBase recombination enzyme) and PB-CAG rtTA (encoding the rtTA protein which initiates gene expression in the presence of doxycycline) were nucleofected into telomerase life-extended human fibroblasts (THF) [19 (link),20 (link)]. p14-positive cells were selected for with 3 μg/mL of puromycin. THF-p14 STING−/− and THF-p14 RIG-I/MDA5−/− cells were generated in the same manner, but the plasmids were inserted into the corresponding THF knock-out cell type.
Free full text: Click here
