Quantifying Microsporidia MB in Anopheles

The detection and quantification of Microsporidia MB were done with specific primers (MB18SF, CGCCGGCCGTGAAAAATTTA; MB18SR, CCTTGGACGTGGGAGCTATC) previously designed to detect Microsporidia MB in An. arabiensis [10 (link), 11 (link)]. Briefly, a 10-µL polymerase chain reaction (PCR) master mix consisting of 2 µL HOT FIREPol Blend Master Mix Ready to Load (Solis BioDyne, Estonia; mix components included HOT FIREPol DNA polymerase, 2 mM of each deoxynucleoside triphosphate and 7.5 mM magnesium chloride), 5 µL of nuclease-free PCR water, 0.5 µL of 5 pmol µL⁻¹ forward and reverse primers, and 1 µL of the sample template, was prepared. The mixture was incubated in a thermocycler set up as follows: initial denaturation at 95 ˚C/15 min, followed by 35 cycles of denaturation at 95˚C/60 s, primer annealing for 90 s at 62 ˚C, extension at 72 ˚C for 60 s, and a final chain elongation step of 72 ˚C for 5 min. A qPCR reaction carried out using the MB18SF/MB18SR primers on a MIC qPCR cycler (Bio Molecular Systems, Australia) was used to determine the intensity of Microsporidia MB infection. These data were normalized by using Anopheles host ribosomal S7 gene primers (S7F, TCCTGGAGCTGGAGATGAAC; S7R, GACGGGTCTGTACCTTCTGG) [21 (link)].