Genetic Manipulation of LDHA and LDHB

The 293T human embryonic kidney cell line, and PANC-1 and Capan-2 pancreatic cancer cell lines were purchased from the American Type Culture Collection and were previously tested for mycoplasma contamination. Cells were routinely cultured in Dulbecco’s Modified Eagle Medium (Macgene, China) with 10% fetal bovine serum (Hyclone, USA). The FLAG-tagged LDHB eukaryotic expression vector was generated by inserting PCR-amplified fragments of the LDHB gene into pcDNA3 (Invitrogen, USA). Lentiviral shRNA vectors of LDHA and LDHB were constructed by cloning short hairpin RNA fragments into pSIH-H1-Puro (System Biosciences, USA). Target sequences are as follows, LDHA shRNA: 5’- ATCCAGTGGATATCTTGACCTACG -3’; LDHB shRNA: 5’- GGATATACCAACTGGGCTATT -3’. Lentiviruses were produced by co-transfection of HEK293T cells with recombinant lentivirus vectors and pPACK Packaging Plasmid Mix (System Biosciences, USA) using PEI reagent (Polyscience, USA). Lentiviruses were used to infect target cells in accordance with the manufacturers’ instructions. Myc-TERT, Flag-TERT, and GST-TERT plasmids were described previously (15 (link)). Sodium pyruvate, Sodium lactate, Methyl pyruvate and IPTG were products from Sigma (USA). 2-DG and AT-101 were purchased from Selleck (USA).