Promoter Methylation Assay of S100A12

We conducted promoter methylation assay by mimicking a previous study^{23 (link)}. The putative promoter region of the S100A12 gene was PCR amplified, followed by being digested with the restriction enzyme HindIII and being cloned into the pGL4.21 luciferase expression vector (Promega, Madison, WI, USA). The vector was then subjected to in vitro methylation by using the M. SssI methyltransferase enzyme (Invitrogen, Grand Island, NY, USA). M. SssI recognizes the sequence pattern CpG and catalyzes the in vitro cytosine methylation at the recognized sequence pattern. Then, a luciferase assay was conducted in 293 T cell by using a Dual-Glo luciferase reporter assay system kit (Promega, Madison, WI, USA) 24 h after transfection. For the qPCR assays, the sequences of PCR primers are as follow: S100A12: forward primer (5′- CTTACAAAGGAGCTTGCAAAC-3′) and reverse primer (5′- GGTGTGGTAATGGGCAG-3′). 18S: forward primer (5′- GTAACCCGTTGAACCCCATT -3′) and reverse primer (5′- CCATCCAATCGGTAGTAGCG -3′).