Cytokine mRNA expression was analysed. Freshly isolated PBMCs were added to 24-well plates (107 cells/well) with or without 1.25 μg/well P. multocida and incubated at 37 °C and 5% CO2 for 3 h. Total RNA was extracted from the stimulated or control PBMCs using TRIzol reagent (Invitrogen, CA, USA) according to the manufacturer’s instructions. Then, reverse transcription (RT) was carried out using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, CA, USA). Real-time PCR was carried out in the SmartCycler I system (Cepheid, Caribbean Sunnyvale, CA, USA) as described previously [13 (link)]. The primers and reaction program for swine cytokine genes and the housekeeping gene GAPDH (glyceraldehyde-3-phosphate dehydrogenase) are listed in Table 2 . The expression of each gene was analysed using the relative quantification method described by Pfaffl [17 (link)]. A slope was determined from the exponential phase, under the optimized real-time PCR amplification condition, of the target gene or the reference gene (GAPDH). The amplification efficiency (E) was calculated based on the slope, where E = 10 [− 1/slope]. The mRNA expression of each target gene was calibrated by that of GAPDH at each time point and converted to the relative expression ratio (fold of induction), where fold of induction = [(E target) × (control CP target − treatment CP target)]/[(Eref) × (control CPref − treatment CP ref)].
| Gene | Primer | Sequence (5′ → 3′) | Length (bp) | Accession No.a | Denaturation | Amplification conditionsb |
|---|---|---|---|---|---|---|
| GADPH | F | TGAATTTGGCTACAGCAACAGG | 186 | XM_039874164.1 | 95 °C (5 min) | 53.2 ℃ (20 s), |
| R | GGTCTGGGATGGAAACTGGA | |||||
| IFN-γ | F | ACTTGGTGTTATGGTGACTG | 197 | X53085 | 57 ℃ (20 s) | |
| R | TAGGATGTCTAGTAGTGAG | |||||
| IL-4 | F | TGACGGACGTCTTTGCTGC | 178 | X68330 | 50.8 ℃ (20 s) | |
| R | TCTGTGCATGAAGCCAAGAA |
F: forwards, R: reverse.
aGenBank accession number of cDNA and corresponding gene, available at National Center for Biotechnology Information.
bDenaturation at 95 ℃ for 45 s and extension at 72 ℃ for 30 s, for a total of 44 cycles.
Free full text: Click here
