The film samples were prepared as described earlier (see Section 2.4.3 ). The L929 mouse fibroblasts and MSCs were seeded by dropping cell suspensions directly to the film samples (1 × 104 cells/sample) and observed by light microscopy on day 4.
To study cell differentiation, MSCs (passage 3–5) were seeded on the film samples previously placed into a 96-well plate (1 × 104 cells/well) or 48-well plate (4x104 cells/well) and cultured in DMEM (10% FBS) for 7 days until 80% confluence was reached. To induce differentiation, the cells were cultivated in OS medium for 7-14 days. The cells cultured in DMEM (10% FBS) were used as a control.
To estimate alkaline phosphatase activity, mesenchymal stromal cells cultured on the film samples in a 96-well plate were used. For this purpose, MSCs were washed twice with PBS (pH 7.4) and then fixed by incubation in a 4% paraformaldehyde solution for 20 min. Then, the cells were washed 3 times with PBS (pH 7.4) and with milliQ (200 μL/well). A leukocyte alkaline phosphatase kit was used for a qualitative assessment of alkaline phosphatase activity following the manufacturer’s instructions. Briefly, 100 μL of the phosphatase was added to each well and incubated for 15 min. Then the cells were rinsed with milliQ (200 μL/well) until the solution was clear. Cell morphology and distribution of differentiated cells on the film samples were studied using light microscopy.
To evaluate MSCs differentiation by qRT-PCR, the cells were cultured on the films in a 48-well plate. After cultivation for 7 and 14 days, the film samples were washed with PBS (pH 7.4), and then RNA was isolated using RNeasy Mini Kit, according to the manufacturer’s instruction. Reverse transcription was carried out using MMLV RT Kit, following the manufacturer’s instruction. qRT-PCR was conducted using qPCRmix-HS SYBR+LowROX Kit and following primers: Runx2 (FV: CGGAATGCCTCTGCTGTTAT; RV: TGTGAAGACGGTTATGGTCAAG), ALPL (FV: TGGAGTATGAGAGTGACGAGAA; RV: GTTCCAGATGAAGTGGGAGTG), SPP1 (FV: CCGAGGTGATAGTGTGGTTTATG; RV: CTTTCCATGTGTGAGGTGATGT), GAPDH (FV: TCGACAGTCAGCCGCATCTTCTTT; RV: ACCAAATCCGTTGACTCCGACCTT).
To study cell differentiation, MSCs (passage 3–5) were seeded on the film samples previously placed into a 96-well plate (1 × 104 cells/well) or 48-well plate (4x104 cells/well) and cultured in DMEM (10% FBS) for 7 days until 80% confluence was reached. To induce differentiation, the cells were cultivated in OS medium for 7-14 days. The cells cultured in DMEM (10% FBS) were used as a control.
To estimate alkaline phosphatase activity, mesenchymal stromal cells cultured on the film samples in a 96-well plate were used. For this purpose, MSCs were washed twice with PBS (pH 7.4) and then fixed by incubation in a 4% paraformaldehyde solution for 20 min. Then, the cells were washed 3 times with PBS (pH 7.4) and with milliQ (200 μL/well). A leukocyte alkaline phosphatase kit was used for a qualitative assessment of alkaline phosphatase activity following the manufacturer’s instructions. Briefly, 100 μL of the phosphatase was added to each well and incubated for 15 min. Then the cells were rinsed with milliQ (200 μL/well) until the solution was clear. Cell morphology and distribution of differentiated cells on the film samples were studied using light microscopy.
To evaluate MSCs differentiation by qRT-PCR, the cells were cultured on the films in a 48-well plate. After cultivation for 7 and 14 days, the film samples were washed with PBS (pH 7.4), and then RNA was isolated using RNeasy Mini Kit, according to the manufacturer’s instruction. Reverse transcription was carried out using MMLV RT Kit, following the manufacturer’s instruction. qRT-PCR was conducted using qPCRmix-HS SYBR+LowROX Kit and following primers: Runx2 (FV: CGGAATGCCTCTGCTGTTAT; RV: TGTGAAGACGGTTATGGTCAAG), ALPL (FV: TGGAGTATGAGAGTGACGAGAA; RV: GTTCCAGATGAAGTGGGAGTG), SPP1 (FV: CCGAGGTGATAGTGTGGTTTATG; RV: CTTTCCATGTGTGAGGTGATGT), GAPDH (FV: TCGACAGTCAGCCGCATCTTCTTT; RV: ACCAAATCCGTTGACTCCGACCTT).
Free full text: Click here
