RNA Isolation and qPCR Analysis

For cells, RNA was isolated using NucleoSpin RNA kit (Clontech) and DNase-treated on column. For embryos, E11.5 neural tubes and somites were dissected and trypsinized as previously described^{1 (link)}. RNA was isolated using Trizol (Invitrogen) and treated with TURBO DNA-free kit (Ambion). For sucrose gradient fractions, RNA was purified by acid phenol/chloroform followed by isopropanol precipitation. 0.5 μg of RNA was converted to cDNA using iScript supermix (BioRad). cDNA was diluted 2-fold and 1 μl used to run a SYBR green detection qPCR assay (SsoAdvanced SYBR Green supermix and CFX384, BioRad). Data was analyzed and converted to relative RNA quantity using CFX manager (BioRad). For sucrose gradient fractions, amount of RNA from individual fractions was expressed as a fraction of the total RNA collected from all fractions. Primers were used at 250 nM per reaction. B-actin and Hoxa9 qPCR primers were previously described^{1 (link)}. Fluc F 5′-CATCACGTACGCGGAATACTT, Fluc R 5′-AAGAGATACGCCCTGGTTC. 18S F 5′ ACATCCAAGGAAGGCAGCAG, 18S R 5′ CATTCCAATTACAGGGCCTC. 28S F 5′ GGGGAGAGGGTGTAAATCTC, 28S R 5′ TCCTTATCCCGAAGTTACGG.