Renal Gene Expression Analysis

The mRNA expression of glyceraldehyde-3-phosphate dehydrogenase (GAPDH), alpha-smooth muscle actin (α-SMA), type 1 collagen, mineralocorticoid receptor, glucocorticoid receptor, Sgk-1, 11βHSD2 and NHE1 in renal cortical tissue, and nephrin and podocin in renal glomeruli were analyzed by RT-PCR using a LightCycler FastStart DNA Master SYBR Green I kit and an ABI Prism 7000 Sequence Detection System (Applied Bio-systems, Foster City, California, USA). The oligonucleotide primer sequences of GAPDH, MR, Sgk-1 and type 1 collagen were as previously described [7 (link),20 (link),21 (link)]. The oligonucleotide primer sequences were: rat α-SMA (NM_012893) sense: ACGGCGGCTTCGTCTTCT, antisense: CCAGCTGACTCCATGCCAAT; rat glucocorticoid receptor sense: 5′-ACAGCTCACCCCTACC TTGGT-3′, antisense: 5′-CTTGACGCCCACCTAACA TGT-3′; rat 11βHSD2 (NM_017081) sense: 5′-CTG GCCACTGTGTTGGATTTG-3′, antisense: 5′-TCCA GAACACGGCTGATATCCT-3′; and rat NHE1 (NM_012652) sense: 5′-ACCACAAGATGGAGATG AAGCA-3′, antisense: 5′-GCAAGATGCGCTCTGAAG CT-3′; nephrin sense: 5′-CCAGAGTGGACGAACTAT ATTGGA-3′, antisense: 5′-GACCAGTAACTGCCCGT TATCC-3′; podocin sense: 5′-CCTTTCCATGAGGTG GTAACCA-3′, antisense: 5′-GGATGGCTTTGGACA CATGAG-3′. All data were expressed as the relative differences between UNX + vehicle group and other groups after normalization to GAPDH expression.