Soil Bacterial 16S rRNA Sequencing

According to the standard kit protocol, total DNA was extracted from 0.5 g soil subsamples using a PowerSoil DNA extraction kit. The purity and quality of the genomic DNA were checked on 0.8% agarose gels. The primer sets 338F (ACTCCTACGGGAGGCAGCAG) and 806R (GGACTACHVGGGTWTCTAAT) were chosen to amplify the V3-V4 hypervariable regions of the bacterial 16S rRNA gene, given that this gene fragment provides sufficient resolution and has little bias for accurate classification of bacteria [36 (link)]. PCR was carried out on a Mastercycler Gradient (Eppendorf, Hamburg, Germany) using 25 µL reaction volumes containing 12.5 µL 2 × TaqPCR Master Mix, 3 µL BSA (2 ng/µL), 1 µL of each primer (5 µM), 2 µL template DNA, and 5.5 mL ddH₂O. The cycling parameters were 95 °C for 5 min, followed by 32 cycles of 95 °C for 45 s, 55 °C for 50 s and 72 °C for 45 s with a final extension at 72 °C for 10 min. Three PCRs per sample were pooled to mitigate reaction-level PCR biases. The PCR products were purified using a QIA quick gel extraction kit (QIAGEN, Dusseldorf, Germany), and sequencing was performed on an Illumina MiSeq PE300 platform (Beijing Allwegene Technology Co., Ltd., Beijing, China).