Amplification and Analysis of AGV Genome

To amplify the complete genome of AGV, PCR assay was carried out as described above, except that primer pair of AGV-F: CGTGTATTGGGTTCTTCAGAC/AGV-R: TGAGCATCGACCTCATTCGG was applied to the PCR amplification and the total DNA above substituted for cDNA as template. The primers were designed based on the sequence flanked by primers AGV-detF/AGV-detR. The PCR products were gel-purified using Gel Extraction Kit (CWBIO, Beijing, China), cloned into pMD18-T simple vector (TaKaRa, USA), and Escherichia coli JM109 competent cells were transformed. Selected clones (three per amplicon) were sequenced at GENEWIZ, Inc., Beijing, China.
The full-length genome sequences were assembled using Vector NTI (Invitrogen) based on overlapping regions, and the ORFs were identified using ORFfinder (https://www.ncbi.nlm.nih.gov/orffinder, accessed on 15 May 2022). SDT 1.0 [25 (link)] was used to determine pairwise nucleotide sequence identities and amino acid sequences among different isolates.