Efficient PTEN mRNA Knockdown Assay

HeLa cells were seeded in 96-well plates at 5000–10 000 cells/well 16 h prior to treatment with the exception of liver hepatocytes which were immediately plated and transfected 2 h post perfusion. Transfection was performed at indicated concentrations using Opti-MEM medium (Life Technologies) containing 4–6-μg/ml Lipofectamine 2000 (Life Technologies) for 4 h at 37°C. Growth medium, Dulbecco's modified Eagle's medium for HeLa and Mouse Fibroblast (MEF) cell lines and Williams E for hepatocytes, was replaced and cells were incubated overnight at 37°C in 5% CO₂. Cells were lysed 16 h post transfection and total RNA was purified using RNeasy 3000 Bio Robot (Qiagen). Reduction of target mRNA was determined by quantitative Reverse Transcriptase Polymerase Chain Reaction (qRT-PCR) as previously described (16 (link)). The primer-probe sequences used for detection of human PTEN were forward AATGGCTAAGTGAAGATGACAATCAT, reverse TGCACATATCATTACACCAGTTCGT and probe TTGCAGCAATTCACTGTAAAGCTGGAAAGG. Target mRNA levels were normalized to total RNA using RiboGreen (Life Technologies). IC₅₀ curves and values were generated using Prism 4 software (GraphPad Prism regression analysis Software).