Preparation of Widom 601L DNA

The 145 bp 601 DNA was prepared as previously described (24 (link),25 ). The palindromic derivative of the Widom 601 DNA, the 193 bp Widom 601L DNA, was generated and prepared as described (26 (link),27 (link)). In brief, multiple repeats of each half of the 601L DNA were generated in the pGEM-T Easy vector. Each half of the 601L DNA was excised from the vector by digestion with EcoRV (Takara), followed by PEG precipitation to separate the vector DNA and the DNA fragment. The resulting DNA fragments were dephosphorylated by Calf Intestinal Alkaline Phosphatase (Takara), extracted by phenol–chloroform extraction, and precipitated with ethanol. DNA fragments were cleaved by HinfI (Takara) and purified through TSK-DEAE ion exchange chromatography. The purified DNA fragments were ligated, and unligated fragments were separated using a Prep Cell apparatus (Bio-Rad). The 193 bp Widom 601L DNA sequence is as follows: ATCACGTAATATTGGCCAGCTAGGATCACAATCCCGGTGCCGAGGCCGCTCAATTGGTCGTAGACAGCTCTAGCACCGCTTAAACGCACGTACGGAATCCGTACGTGCGTTTAAGCGGTGCTAGAGCTGTCTACGACCAATTGAGCGGCCTCGGCACCGGGATTGTGATCCTAGCTGGCCAATATTACGTGAT.