The genomic DNA of the consortium was extracted according to the instructions of the genome extraction kit (TIANGEN BIOTECH, China). The primers 338F (ACTCCTACGGGAGGCAGCAG) and 806R (GGACTACHVGGGTWTCTAAT) were used to amplify the V3–V4 region of the 16S rDNA with the Phanta Max Super-Fidelity DNA Polymerase (Vazyme, China) in a 50-µL final volume (Su et al. 2021 (link)). The PCR conditions were as follows: initial denaturation at 95 °C for 3 min; 30 cycles of denaturation at 95 °C for 10 s, annealing at 56 °C for 15 s, and extension at 72 °C for 1.5 min; then final extension at 72 °C for 10 min. The expected length of the PCR product was 1.6 kb. A total of 100 ng purified DNA product was prepared for amplicon sequencing using the NovaSeq platform (Allwegene, China). At least 40,000 reads were acquired for each sample. The sequence data has been deposited in the GenBank database under the BioProject accession number PRJNA888221.