Generation of CHO Cell Mutants with Eogt and Pofut1 Knockouts

CHO Lec1^{25 (link)} cells with inactivated Pofut1 were previously described as Pofut1 KO-1 (P4–11) and KO-2 (P4–15)^{36 (link)}. The Pofut1 deletion was confirmed by western blotting with a rabbit anti-bovine POFUT1 antibody^{37 (link)}. To inactivate Eogt, two guide RNAs (GTATGACTACTCCAGCCTCC in exon 1; Eogt2 GTTTGCAGCTATGTCGACGT in exon 2), an ATTO 550-labeled tracrRNA and Cas9 (all from Integrated DNA Technologies, Inc., Coralville, IA) were lipofected into Lec1 cells. After 24 h, ATTO 550+ cells were sorted by flow cytometry and the 3% most positive cells were seeded at 1 cell per well in alpha minimal essential medium (αMEM, Thermo Fisher Scientific, Waltham, MA) containing 10% fetal bovine serum (FBS) and 1% Penicillin–Streptomycin. Lec1 Pofut1 KO-1 cells were transformed by lipofection with the same Eogt gRNAs to generate Eogt:Pofut1 dKO mutants. After 8–10 days, colonies were expanded and characterized. Genomic DNA PCR detected Eogt alleles (Supplementary Figure S1A) and RT-PCR detected cDNA products (Supplementary Figure S1B) as described^{21 (link)}. Mutants were designated E116 (Eogt KO) and PE316 (Eogt:Pofut1 dKO).