CRISPR-Mediated Knockout of Key Genes

Knockout of the CDK1, DGAT1, DGAT2, and RB1 genes in human cell lines was performed using single guide RNAs (sgRNAs) and CRISPR/Cas9 technology. gRNAs were cloned into the lentiviral plasmid lentiCRISPR v2 or lentiGuide_Puro (Addgene). sgCDK1: ‘TACTTTGTTTCAG GTACCTA’, ‘GGGTTCCTAGTACTGCAATT’, ‘CATAAGCACATCCTG AAGAC’; sgDGAT1: ‘TTAGAGGCGCCCACCACACC’, ‘CACCCCCAGGTATGGCATCC’, ‘CAGGATGCCATACC TGGGGG’; sgDGAT2: ‘CGAGTGCGATACCATTCCCA’, ‘TATGCAGGACTGGACCACCT’, ‘CATGTGAACTTGGGACACCC’; sgRB1: ‘GCTCTGGGTCCTCCTCAGGA’, ‘TCGCTCACCT GACGAGAGGC’, ‘TTCATCTGTGGATGGAGTAT’. gRNA clones were transfected into HEK293T cells with psPAX2 packaging plasmid and pMD2.G VSV-G envelope-expressing plasmid as described previously^{35 (link),36 (link)}. Caki-1 cells were infected with lentivirus along with 0.8 μg/ml hexadimethrine bromide (Polybrene; Millipore, #TR-1003-G) and selected with puromycin (2 μg/ml; InvivoGen, #ant-pr-1) for 3 days. For CDK1 knockout, gRNAs were cloned into the lentiGuide-Puro vector (Addgene; #52963). Caki-1 cells carrying doxycycline-inducible Cas9 were cultured with tetracycline-free fetal bovine serum (Takara Bio, #631107) and infected with gRNAs targeting CDK1. doxycycline (1 μg/ml; Sigma, D9891) was added into the media for 3 days to generate CDK1-knockout cells.