The mCherry coding sequence was amplified via PCR using plasmid CD3-960 (Nelson et al., 2007 (link)) as template and primers 5′-AAAAGCTAGCAAAGAATTCATGGTGAGCAAGGGCGAGG AG-3′ and 5′-TTTCTCGAGTTTGTACAGCTCGTCCATGC-3′ flanked by NheI and XhoI recognition sites. The PCR product and pET21b were digested with NheI and XhoI, gel-purified, and ligated to yield pET-mCherry-6xHis (pMS1034). pMS1034 was used as a template for PCR to add the coding sequence for the 1xHA motif via primers 5′-AAAAGGATCC TATCCGTATGATGTGCCAGATTATGCCT GAGATCCGGCTGCTAACAAA-3′ and 5′-TTTTGGATCC GTGGTGGTGGTGGTGGTGCTCGAG-3′ (BamHI sites are underlined). The resulting 6,140 bp PCR product was digested with BamHI and recircularized, giving rise to pET21b-mCherry-6xHis-1xHA (pMS1090). mCherry-6xHis-1xHA was expressed in ER2566 cells in LB-medium (supplemented with 100 μg/mL ampicillin (K029.2, Carl Roth)) after inducing the expression with 0.5 mM IPTG at 37°C for 4 h and purified under denaturing conditions as described previously (Hammel et al., 2018 (link)) using nickel-charged resin. The concentration of recombinant mCherry-6xHis-1xHA was determined using the Pierce BCA protein assay kit following the manufacturer’s instructions.
Free full text: Click here
