Total RNA was isolated from treated HPMCS using the Qiagen RNeasy kit and transcribed into cDNA, as previously described6 (link),24 (link). uPAR (PLAUR), uPA (PLAU), LRP1 and α-SMA (ACTA2) gene expression was then determined by qPCR analyses on a Bio-Rad CFX Touch (Table 2 ). GUSB and GAPDH were used as loading controls.
Includes the reference information for the genes used in the detailed qPCR analyses.
| Primer | Sequence |
|---|---|
| uPA (PLAUR) | Bio-Rad Prime PCR Probe Assay: Cy5 Fluorophore, qHsaCIP0031103 |
| uPA (PLAU) | Bio-Rad Prime PCR Probe Assay: Cy5.5 Fluorophore, qHsaCIP0032518 |
| LRP1 | ACATATAGCCTCCATCCTAATC GCTTATACCAGAATACCACTC |
| α-SMA (ACTA2) | Bio-Rad Prime PCR Probe Assay: FAM Fluorophore, qHsaCIP0028813 |
| GUSB | Bio-Rad Prime PCR Probe Assay: HEX Fluorophore, qHsaCIP0028142 |
Free full text: Click here
