PLXNB2 knockdown was commonly achieved by lentiviral‐mediated transfer of a validated puromycin‐selectable construct expressing a targeted shRNA and GFP marker (Origene, cat. TL317033B; targeting seq. 5′‐CCACTGGCTGTGGAGCCGAAGCAAGTCCT‐3′). For validation experiments, we transferred an independent shRNA sequence carried by TRCN0000048188 clone (targeting seq. 5′‐GCTCTACCAATACACGCAGAA‐3′), provided by Sigma‐Aldrich. For overexpression experiments, a cDNA construct encoding human PlxnB2 (VSV‐tagged, provided by Jun Takagi, Osaka, Japan) was subcloned into the lentiviral expression construct pLVX. Moreover, a cDNA fragment containing the sequence encoding PLXNB2‐G842C mutation was produced by gene synthesis (BioCat GmbH, Heidelberg, Germany) and replaced to the wild‐type sequence, by restriction site‐mediated recombination, in the expression construct.
Lentiviral‐mediated gene transfer was performed as described previously (Follenzi & Naldini, 2002 (link); Brown et al, 2020 (link)). Briefly, nonreplicating viral particles containing constructs expressing cDNA or shRNAs (or pGFP‐C‐shRNA Vector [Origene], as control) were produced in HEK‐293 T packaging cells by the calcium phosphate precipitation method. The harvesting of viral particles was carried out 48 h after transfection: the conditioned medium was filtered and centrifuged at 19,500 rpm for 2 h to obtain concentrated viral suspensions. Host cells were then incubated with viral particle‐containing media in the presence of 8 μg/ml polybrene at 37° (multiplicity of infection [moi] = 5); CUP cells were dissociated from agnospheres and incubated with viral particles in suspension. Gene‐transduced cells were then selected by 0.5 μg/ml puromycin treatment.
Lentiviral‐mediated gene transfer was performed as described previously (Follenzi & Naldini, 2002 (link); Brown et al, 2020 (link)). Briefly, nonreplicating viral particles containing constructs expressing cDNA or shRNAs (or pGFP‐C‐shRNA Vector [Origene], as control) were produced in HEK‐293 T packaging cells by the calcium phosphate precipitation method. The harvesting of viral particles was carried out 48 h after transfection: the conditioned medium was filtered and centrifuged at 19,500 rpm for 2 h to obtain concentrated viral suspensions. Host cells were then incubated with viral particle‐containing media in the presence of 8 μg/ml polybrene at 37° (multiplicity of infection [moi] = 5); CUP cells were dissociated from agnospheres and incubated with viral particles in suspension. Gene‐transduced cells were then selected by 0.5 μg/ml puromycin treatment.
Free full text: Click here
