Annealing and Characterization of DNA Oligonucleotides

Sense (s) and antisense (as) 45-nt (s, 5′-TACAGATCTACTAGTGATCTATGACTGATCTGTACATGATCTACA-3′; as, 5′-TGTAGATCATGTACAGATCAGTCATAGATCACTAGTAGATCTGTA-3′)^{32 (link)} and 100-nt oligonucleotides (s, 5′-ACATCTAGTACATGTCTAGTCAGTATCTAGTGATTATCTAGACATACATCTAGTACATGTCTAGTCAGTATCTAGTGATTATCTAGACATGGACTCATCC-3′; as, 5′-GGATGAGTCCATGTCTAGATAATCACTAGATACTGACTAGACATGTACTAGATGTATGTCTAGATAATCACTAGATACTGACTAGACATG TACTAGATGT-3′)^{27 (link)} were purchased at 1 µmol scale from IDT and dissolved in 150 mM NaCl, 1 mM dithiothreitol (DTT), 20 mM Tris-HCl, pH 7.5, annealing buffer to obtain a 1-mM single-stranded DNA stock solution. The quality of oligonucleotides was verified by denaturing polyacrylamide gel electrophoresis. Annealing of s and as strands was conducted by incubating 200 µM each of s and as strand in annealing buffer at 95 °C for 90 s followed by slow cooling to 25 °C at a rate of 0.1 °C s⁻¹ in a Peltier thermocycler (BioRad). The completion of annealing was verified by native agarose gel electrophoresis^{32 (link)}. A modified pUT7 plasmid corresponding to 3200-bp DNA was isolated from transformed Escherichia coli Top10 with a PureLink HiPure Plasmid Megaprep Kit (Invitrogen). The plasmid was linearized with HindIII (NEB) and further purified by standard ethanol precipitation method and resuspended in MilliQ water. Herring testes DNA (HT-DNA) was purchased from Sigma (catalog number: D6898).