Generating ALC1 Knockout Cells

ALC1 targeting vector was constructed to replace part of the 8th exon with a resistance (Puro and Neo)-gene cassette flanked by loxP signals at both ends. The primers used to amplify the left arm were 5’-CCTCGAGCTCAGTAGTCTTCAGTCTCCTGTTGAC-3’ and 5’-GGCTAGCGCTGCAAGAGTTTGTGCAGTTCACTTG-3’, and the primers for the right arm were 5’-GGCGGCCGCGCATTGCAGAAGAAATACTACAAGGCC-3’ and 5’-GGTCGACATATGGGTGATCCACACACTTTCGAAG. Expression vector for transcription activator-like effector nuclease (TALEN) was designed to recognize the following sequences according to the method described in Sakuma et al [25 (link)].: 5’-TGCACAAACTCTTGCAG-3’ and 5’-CGAGTGAAAGCTGAGGTA-3’. To generate ALC1^-/- cells, wild-type TK6 cells were transfected with the ALC1 targeting vectors (Puro^R and Neo^R) with expression vector for TALEN using NEON transfection system (Invitrogen, CA) at 1500 V 20 msec. The loss of ALC1 transcript was confirmed by RT-PCR using primers 5’- CAAGAAGACA GAAGTAGTGA TATACCATGG-3’ and 5’- CCATATAGTCTTGGAGAATATCCAACATCT-3’. GAPDH transcripts were analyzed as a positive control for the RT-PCR analysis using primers 5’- TGGCCAAGGTCATCCATGACAACTT-3’ and 5’- GCGCCAGTAGAGGCAGGGATGATGT -3’. The loss of ALC1 protein was confirmed by western blot using anti-ALC1 antibody (abcam, ab51324). β-actin was detected using specific antibody (Sigma, A5441) as a loading control.