Quantitative Analysis of LKB1 Expression in Zebrafish Embryos

Total RNAs of approximately 40 zebrafish embryos at 48 h post fertilization (hpf) were extracted as previously described^{76 (link),77 (link)}, and were then reverse transcribed (TaKaRa, PrimeScriptTM RT-PCR kit DRR014A) to obtain cDNAs for use as Quantitative Real-time PCR (qPCR) templates. The qPCR assays were performed (Accurate Biology, SYBR Green Premix Pro Taq HS qPCR Kit) using a CFX96 real-time system (Bio-Rad), and the expression level of β-actin in zebrafish embryos was used as an internal control. The primer sequences used were as follows:
LKB1 Forward: GTGAAGGAGATGCTGGACTCGG
LKB1 Reverse: CAGCACGTCCACCAGCTGAATG
ACTIN Forward: GTACCCTGGCATTGCTGAC
ACTIN Reverse: CTGCTTGCTGATCCACATCTG

Free full text: Click here

Tu Y., Yang Q., Tang M., Gao L., Wang Y., Wang J., Liu Z., Li X., Mao L., Jia R.Z., Wang Y., Tang T.S., Xu P., Liu Y., Dai L, & Jia D. (2024). TBC1D23 mediates Golgi-specific LKB1 signaling. Nature Communications, 15, 1785.

Publication 2024

SYBR Green Premix Pro Taq HS qPCR Kit CFX96 real-time system

Corresponding Organization :

Other organizations : Sichuan University, Nanjing Medical University, Institute of Zoology, Chinese Academy of Sciences, Zhejiang University

Top 5 similar protocols

Variable analysis

independent variables

None explicitly mentioned

dependent variables

Expression level of LKB1 gene

control variables

Expression level of β-actin gene (used as internal control)

controls

Positive control: Not mentioned
Negative control: Not mentioned

Annotations

Based on most similar protocols

Etiam vel ipsum. Morbi facilisis vestibulum nisl. Praesent cursus laoreet felis. Integer adipiscing pretium orci. Nulla facilisi. Quisque posuere bibendum purus. Nulla quam mauris, cursus eget, convallis ac, molestie non, enim. Aliquam congue. Quisque sagittis nonummy sapien. Proin molestie sem vitae urna. Maecenas lorem.

As authors may omit details in methods from publication, our AI will look for missing critical information across the 5 most similar protocols.

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!