Quantifying Apoptosis and Inflammation

Fresh sections of harvested kidney and liver tissues were rinsed with ice-cold PBS; thereafter, they were used to extract the total mRNA using Trizol isolation reagent (Thermo Scientific, MA, USA). The extracted mRNA was quantified, and 300 ng/weight was used for cDNA determination for both apoptotic and inflammatory marker expressions. The forward primers (GAAATTCCTGATCCAGACAAAAAC, TGGACCTTCCAGGATGAGGACA and GCAAGGATACTGAGAGCAAGAG) and reverse primers (ATCACTTCAATGGCCTCTGTGTAG, GTTCATCTCGGAGCCTGTAGTG and GGATGGAATTGTGAGGGAGATG) for NF-κB, IL-1β and glyceraldehyde 3-phosphate dehydrogenase (GAPDH), respectively, were used. The expression of cDNA products was investigated using method detailed by Ibrahim et al. [31 (link)].