CRISPR-Cas9–mediated genome editing was carried out as described (24 –26 (link)), with the use of murine IRF1 target sequence GAAGCACGCTGCTAAGCACGG . Briefly, plasmid encoding gRNA, Cas9-mCherry was transfected into MC38, CT26 and B16-F10 parental cell lines with lipofectamine 3000 (Thermo Fisher Scientific, Waltham, MA). After 48 h of transient transfection, mCherry+ single cells were sorted into 96-well cell culture plates. Single cell clones were expanded and transferred into 12-well cell culture plate. Cells were treated with 100 ng/mL mouse IFNγ (Biolegend, San Diego, CA) for 6 h before harvesting. We examined the expression of IRF1 via western blot.
Mouse PD-L1 coding region (PD-L1) was PCR amplified from pUNO mouse CD274 (Addgene Plasmid# 107012) using primers 5’- CACCATGAGGATATTTGCTGGCATTATAT TCAC - 3’) and 5’ - GAGTTTGGTGACTACATCTTAAGATCTATCATGTCGTC - 3, TOPO cloned into pENTR D-TOPO and transferred into pInducer20 vector using Gateway Cloning (Thermo Fisher Scientific). B16-F10 IRF1-KO cells were transduced with lentivirus prepared from pInducer20-PD-L1 and selected by G418 (800 μg/mL) to make a stable cell line. Doxycycline (DOX) induced expression of PD-L1 in B16-F10 IRF1-KO cells was confirmed by western blot.
Mouse PD-L1 coding region (PD-L1) was PCR amplified from pUNO mouse CD274 (Addgene Plasmid# 107012) using primers 5’- CACCATGAGGATATTTGCTGGCATTATAT TCAC - 3’) and 5’ - GAGTTTGGTGACTACATCTTAAGATCTATCATGTCGTC - 3, TOPO cloned into pENTR D-TOPO and transferred into pInducer20 vector using Gateway Cloning (Thermo Fisher Scientific). B16-F10 IRF1-KO cells were transduced with lentivirus prepared from pInducer20-PD-L1 and selected by G418 (800 μg/mL) to make a stable cell line. Doxycycline (DOX) induced expression of PD-L1 in B16-F10 IRF1-KO cells was confirmed by western blot.
