Generation of Inducible Rag1/Rag2 Mouse Line

In order to generate a mouse line in which Rag1 and Rag2 expression could be induced from the Rosa26 locus by removal of the STOP cassette upon Cre expression, we used 2A peptides79 (link) for bicistronic expression. We amplified the mouse Rag2 coding region from genomic DNA by PCR reaction with primers (Rag2-5′ and Rag2-2A-3′) which allowed us to add 2A peptide sequences after the stop codon for Rag2 translation. We also amplified Rag1 cDNA by PCR. These PCR products were cloned into the pCR-TOPOII vector (Invitrogen), and their sequences verified. We then inserted the Rag2-2A fragment in front of the Rag1 cDNA fragment in pCR-TOPOII, followed by preparation of an entire Rag2-2A-Rag1 fragment by NotI digestion and a ligation into the NotI site of the pCTV vector (Addgene) (Supp Fig. 2a). The linearized targeting vector was transfected into M1 embryonic stem (ES) cells by electroporation. After G418 selection, ES clones that underwent homologous recombination were screened by PCR as previously described80 (link). Primers: Rag2-5′ (5′- CGGCGCGCC AGCATAATTACCAATATGAAAAGATATTC-3′), Rag2-2A-3′ (5′- CGGATCCCCTGGGCCAGGATTCTCCTCGACGTCACCGCATGTTAGCAGACTTCCTCTGCCCTCTCCACTGCCATCAAACAGTCTTCTAAGGAAGGATTTC-3′), Rag1-5′ (5′-GGATCCTATGGCTGCCTCCTTGCCGTCTACCCTGAGC-3′) and Rag1-3′ (5′- CGGCGCGCCATGTGGAGATCCTATTTAAAACTCCATTGA -3′).