Quantitative Analysis of NbPCaP1L Gene Expression

Inoculated leaves of NbPCaP1L knockdown N. benthamiana were collected and ground. Total RNA was extracted as described (Lin et al., 2007 (link)). First-strand cDNA was synthesized with 20 pmole 39d(T) oligo primer and reverse transcriptase (Promega) according to the manufacturer’s protocol. Real-time quantitative PCR was performed in a 20 μl-reaction containing a 1000X dilution of SYBR green I (Cambrex Bio Science Rockland, ME, USA) with primer GT11_5′ (5′- AAGGTTGTTCCAAAATTAAAGC-3′) and GT11_3′ (5′- TTCAATCCTGAAACCTTTGGTCCC-3′) in 0.2-ml PCR tubes. The conditions began with an initial hold at 95°C for 5 min, followed by 30 cycles of 94°C for 30 sec, 56°C for 30 sec and 72°C for 30 sec. The expression of β-actin was amplified with the primer pair actin_5′ (5′ GATGAAGATACTCACAGAAAGA 3′) and actin_3′ (5′ GTGGTTTCATGAATGCCAGCA 3′) as an internal control for normalization.