Quantification of HIV RNA and DNA

The HIV RNA and DNA copy numbers were quantified by generating a standard curve. A 500 bp gBlock gene fragment encompassing the gag region [11 (link)] was synthesized (Integrated DNA Technologies, Coralville, IA, USA). The copy number was calculated using the DNA copy number web tool (ThermoFisher, Waltham, MA, USA) and converted to an RNA copy number by multiplying by 2. The fragment was suspended in sterile TE buffer at dilutions ranging from 10 to 10⁶ copies/μL, aliquoted and stored at −80 °C. The RNA extracted from the tissues was quantified using a nanodrop and approximately 500 ng total RNA was converted into cDNA using Qscript cDNA synthesis (Quanta Biosciences, Gaithersburg, MD, USA). The assay was performed with the Qultraplex 1-Step Toughmix Low (Quanta Biosciences, Gaithersburg, MD, USA) on the QuantStudios 5. The PCR conditions were 50 °C for 10 min and 95 °C for 3 min, followed by 40 cycles of 95 °C for 3 s and 55 °C for 30 s. The sequences of primers and probes used were as follows: Gag Probe FAM, /55-FAM/TTCGCAGTC/ZEM/AAT; Gag Forward Primer, GCAAGCAGGGAACTAGAAAGA; Gag Reverse Primer, CTGTCTGAAGGGATGGTTGTAG. The amount of tissue processed, total volume of nucleic acids extracted and dilutions performed at each step (cDNA synthesis, qPCR set up etc.) were considered in the calculations to finally equate to the copy number of viral nucleic acids per mg of tissue.