Construction of pTarget GLuc-Δ1D2A Plasmid

The pTarget GLuc-Δ1D2A plasmid vector was constructed as previously described (22 (link)). Amplification of the 3C protease gene from an FMDV Asia1 Lebanon 1989 (GenBank accession no. AY593798) noninfectious template was performed using OneTaq 2× master mix with Standard Buffer (New England BioLabs) and primers XmaI-3C-F (CTACCCGGGCCGAGTGGTGCCCCAC) and 3C-NotI-R (TAGCGGCCGCTACTCGTGGTGTGGTTC). The PCR product was purified using a PCR purification kit (Qiagen). Both the PCR product and pTarget GLuc-Δ1D2A vector were digested with XmaI and NotI-HF restriction enzymes (New England BioLabs). Ligations were performed using T4 DNA ligase (Roche) and transformed into NEB 5-alpha competent E. coli (New England BioLabs). Plasmids were isolated using a QIAprep Spin Mini-prep kit (Qiagen) and were amplified with primers T7 (TAATACGACTCACTATAGGG) and Seq-R (TTACGCCAAGTTATTTAGGTGACA) for sequencing, and results were analyzed with Sequencher 4.8 software (Genecodes).