Total protein was isolated by lysing cells with RIPA buffer (Beyotime, China) and was quantified with a BCA assay kit (Sangon, China). Total protein (50 μg) was separated by electrophoresis (10% SDS-PAGE) and transferred to a PVDF membrane (Millipore, USA). After treatment with a skim milk powder for 2 h at room temperature, the membrane was incubated overnight with a primary antibody reactive with either; CKAP2L (ab221897, Abcam), CDK1 (ab133327, Abcam), Cyclin B1 (4138, CST), or GAPDH (5174, CST) at 4°C. The next day, secondary antibodies conjugated with horseradish peroxidase (HRP) were incubated with the membranes for 2 h. Protein signals were detected with ECL reagents (Invitrogen) [34 (link)].
Total RNA was isolated from ESCC tissues and cells using TRIzol reagent (Invitrogen). cDNA synthesis was done with a PrimeScript RT reagent Kit (Takara, Japan). RT-qPCR was performed with SsoFast EvaGreen Supermix (Bio-Rad, USA) and an ABI Prism 7500 Sequence Detection System according to the manufacturer's instructions. The primers used were as follows: CKAP2LF: GGGAAAACTGAAGAGCCAAAACA; CKAP2LR: AGGTTTGACAGGCAAAACAACA;β-actin F: TGGCACCCAGCACAATGAA,β-actin R: CTAAGTCATAGTCCGCCTAG AAGCA. Relative gene expression was normalized to β-actin based on the 2−ΔΔCt method [35 (link)].
Total RNA was isolated from ESCC tissues and cells using TRIzol reagent (Invitrogen). cDNA synthesis was done with a PrimeScript RT reagent Kit (Takara, Japan). RT-qPCR was performed with SsoFast EvaGreen Supermix (Bio-Rad, USA) and an ABI Prism 7500 Sequence Detection System according to the manufacturer's instructions. The primers used were as follows: CKAP2LF: GGGAAAACTGAAGAGCCAAAACA; CKAP2LR: AGGTTTGACAGGCAAAACAACA;β-actin F: TGGCACCCAGCACAATGAA,β-actin R: CTAAGTCATAGTCCGCCTAG AAGCA. Relative gene expression was normalized to β-actin based on the 2−ΔΔCt method [35 (link)].
Free full text: Click here
