Methylation Analysis of HPV-16 L1 Gene

Mixed the completely methylated and unmethylated HPV-16 L1 gene standards in 0%, 10%, 25%, 50%, 75%, and 100% methylated to unmethylated template ratios, which served as the methylation standards for MS-HRM.

Extracted the HPV viral DNA by DNA extraction kit.

The methylation standards and all extracted HPV viral DNA were bisulfite modified; the detailed steps referred to the instruction book of EpiTect Bisulfite Kit.

The specific PCR primers used were that, Forward primer:5′ GCGCATTATTGTTGATGTAGGTGATTTTTATTTATATTTTAG3′, reverse prime: 5′: GCCGCACTAAACAACCAAAAAAACATCTAAAAAAAAATA 3′. The detailed steps of MS-HRM PCR referred to the handbook of EpiTect HRM PCR.

The HRM data were analyzed using the Genescanning Software (Roche).^{[11 (link)]}