Generating Deletion Mutants of TFG

As previously described [18 (link)], the full-length TFG was generated by PCR amplification using pcDNA3.1/NT-GFP-TOPO TA Expression Kits (Invitrogen, Thermo Fisher Scientific, Waltham, MA). The deletion-mutations were generated by PCR amplification based on template pcDNA3.1/NT-GFP-TOPO TFG plasmid using pfuUltra II (Agilent Technologies, Santa Clara, CA). The sequences of primers used to generate those mutants were as following: del1_primer: GGATCTAAGTGGGAAGCTAAGACCCCTTGAATCAAGTC; del2_primer: TTTGTTAATGGCCAGCCACAAACTTCTCAGCCTACT; del3_primer: ACAAACTTACACTGCCCAAACTGGACCTGGTTATCGATAA.

Free full text: Click here

Ma C., Hokutan K., Shen Y., Nepal M., Kim J.H., Zhang J, & Fei P. (2020). TFG-maintaining stability of overlooked FANCD2 confers early DNA-damage response. Aging (Albany NY), 12(20), 20268-20284.

Publication 2020

pcDNA3.1/NT-GFP-TOPO TA Expression Kits pfuUltra II

Deletion mutations Plasmid Primer Topo

Corresponding Organization :

Other organizations : University of Hawaii System, University of Hawaiʻi at Mānoa, WinnMed, Mayo Clinic in Florida

Top 5 similar protocols

Variable analysis

independent variables

Generation of full-length TFG by PCR amplification using pcDNA3.1/NT-GFP-TOPO TA Expression Kits
Generation of deletion-mutations by PCR amplification based on template pcDNA3.1/NT-GFP-TOPO TFG plasmid using pfuUltra II

dependent variables

Not explicitly mentioned

control variables

Not explicitly mentioned

controls

Positive control: pcDNA3.1/NT-GFP-TOPO TFG plasmid
Negative control: Not specified

Annotations

Based on most similar protocols

Etiam vel ipsum. Morbi facilisis vestibulum nisl. Praesent cursus laoreet felis. Integer adipiscing pretium orci. Nulla facilisi. Quisque posuere bibendum purus. Nulla quam mauris, cursus eget, convallis ac, molestie non, enim. Aliquam congue. Quisque sagittis nonummy sapien. Proin molestie sem vitae urna. Maecenas lorem.

As authors may omit details in methods from publication, our AI will look for missing critical information across the 5 most similar protocols.

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!