Cloning and Sequencing of A. rubens NPY/NPF-like Peptide Precursor

A transcript encoding the A. rubens precursor of an NPY/NPF-like peptide was reported previously (GenBank: MK033631) (Zandawala et al., 2017 (link)). However, in this paper we show that the NPY/NPF-like peptide derived from this precursor shares more sequence similarity with PrRP-type peptides. A cDNA containing the complete open reading frame of the precursor was amplified by PCR using A. rubens radial nerve cord cDNA, the forward primer AAGTCAAAAGGCGAGCAAGA, the reverse primer AAAGGGATGTGGTGTTGGTG and Q5 polymerase (NEB; Cat. No. M0491S). The PCR products were ligated into the pBluescript II KS (+) vector (Invitrogen; Cat. No. K280002) that had been cut previously with the restriction enzyme EcoRV by performing blunt-end ligation with T4 DNA ligase (NEB; Cat. No. M0202S). The cloning was confirmed by restriction enzyme digestion and sequencing (TubeSeq service; Eurofins Genomics).