Oligonucleotide Duplexes with Modified Bases

Sequences of the oligonucleotide duplexes used in the present work are shown in Table 1. All oligonucleotides containing modified bases and their complementary strands were purchased from Eurogentec (Seraing, Belgium) including the following: 40-mer d(AATTGCTATCTAGCTCCGCXCGCTGGTACCCATCTCATGA) where X is either hypoxanthine (Hx), 8oxoA, 1,N⁶-ethenoadenine (ϵA), tetrahydrofuran (THF, an abasic site analog), 7,8-dihydro-8-oxoguanine (8oxoG), ϵC, 5,6-dihydrouracil (DHU), alpha-2′-deoxyadenosine and complementary 40-mer d(TCATGAGATGGGTACCAGCGTGCGGAGCTAGATAGCAATT) where T is opposite to the lesion. The oligonucleotides were 5′-end labeled with [γ-³²P]-adenosine triphosphate (ATP) (PerkinElmer, France) and then annealed with corresponding complementary strands as described previously (47 (link)). The resulting oligonucleotide duplexes are referred to in the text as X•Y (NYN), where X is a residue in the [³²P]-labeled top strand, Y is a residue opposite to X in the complementary non-labeled bottom strand and N is a regular DNA base immediately neighboring the 5′ and 3′ sites of Y.