Characterization of MITF Promoter Activity

Approximately 2.3 kb of the MITF promoter (−2293 to +120) and the various truncated promoters were cloned into pGL2 (Promega), and the CRE mutant −1.1 kb promoter construct was generated by PCR directed mutagenesis as described [15 (link)]. The sequence of the wild type and mutant CRE site are: CRE wild type: 5′…TTTGATAGTGACGTCAAGCCA…3′, CRE mutant: 5′…TTTGATAGCGACGTCAAGCCA…3′. Cells were transfected with 1μg of different MITF-reporter constructs and 0.5 μg of pSV-beta-galactosidase. Cultures were assessed for luciferase activity after 48 h using a Firefly Luciferase assay kit (Biotium 30003-1). The data are corrected for beta-galactosidase using the Galacto-Light Plus kit (Thermo Fisher T1007) and represent activity for assays performed in triplicate, with error bars representing standard errors from the mean.