Doxycycline-inducible c-Met Knockdown Cell Lines

The doxycycline-inducible sh-cMet cell line and MET overexpression cell lines were generated as previously described [7 (link)]. Briefly, the doxycycline-inducible shMet plasmid was generated by cloning sh-c-Met sequence (annealed two oligonucleotides; 5′-CCGGCAGAATGTCATTCTACATGAGCTCGAGCTCATGTAGAATGACATTCTGTTTTT-3′, and 5′-AATTAAAAACAGAATGTCATTCTACATGAGCTCGAGCTCATGTAGAATC ACATTCTG-3′) into Tet-PLKO-Puro vector (Addgene). The c-Met overexpression plasmid was purchased from Origene. Recombinant LCN2 and G-CSF were purchased from R&D system (#1857-LC and #214-CS). LCN2 antibody was purchased from R&D system (#AF1857). doxycycline was purchased from Sigma Co, Burlington, NJ, USA.