The genomes of phage KP32 and KP34 are deposited in the genomic database (GenBank): GQ413937 and GQ413938, respectively. TTPA encoding genes were selected for overexpression. Bacteriophage genes were obtained using polymerase chain reaction (PCR) with the following primers: TTPA from KP32 FW – GGATCCCATATGAACATGCAAGATGCTTAC, RV – GAATTCAAAGCTTACGACCGATGAGACCCT, TTPA from KP34 FW – GGATCCCATATGAGAGAACTTGATGCAATT, RV – GAATTCAAAGCTTAATACCATAAAACGAGCGCG.
The DNA of the bacteriophages was prepared as previously described41 (link). PCR reactions were conducted using a two-phase program. The first phase consisted of seven and the second phase of 23 cycles. Taq polymerase (Fermentas) was used and the extension times for each gene were appropriate to gene length, min. 30 seconds to max. 2 minutes. Annealing temperature in the first phase was 48–52 °C and in the second phase 55–65 °C.
PCR products were cloned into the pGEM T-easy vector (T-vector, Promega) using T4 ligase. Constructs were transformed into E. coli DH5α bacteria using the heat-shock method and sequenced. Correct sequences were recloned into pET28a (Promega) expression vectors to obtain the phage tail proteins with an N-terminal six-histidine tag. Plasmid transformation into the competent E. coli BL21(DE3)plysS (Promega) cells was done using the heat shock method.
The DNA of the bacteriophages was prepared as previously described41 (link). PCR reactions were conducted using a two-phase program. The first phase consisted of seven and the second phase of 23 cycles. Taq polymerase (Fermentas) was used and the extension times for each gene were appropriate to gene length, min. 30 seconds to max. 2 minutes. Annealing temperature in the first phase was 48–52 °C and in the second phase 55–65 °C.
PCR products were cloned into the pGEM T-easy vector (T-vector, Promega) using T4 ligase. Constructs were transformed into E. coli DH5α bacteria using the heat-shock method and sequenced. Correct sequences were recloned into pET28a (Promega) expression vectors to obtain the phage tail proteins with an N-terminal six-histidine tag. Plasmid transformation into the competent E. coli BL21(DE3)plysS (Promega) cells was done using the heat shock method.
Free full text: Click here
