Efficient Gene Editing in Mouse Zygotes

We targeted enhancer 1 within the Wap super-enhancer^{28 (link)} (Wap Gene ID: 22373). The Wap-E1 sgRNA (GGCACAGTATGGGCCCTTCT)^{28 (link)}, which contains two cytidines and two adenines near the editing window, was designed and synthesized using ThermoFiser’s sgRNA in vitro transcription service. The pCMV-BE4 plasmid (from David Liu’s laboratory) and pCMV-ABE7.10 plasmid (Addgene plasmid #102919) were linearized and then their mRNAs were synthesized in vitro using the mMESSAGE mMACHINE T7 kit (ThermoFisher Scientific). Mouse zygotes were produced by in vitro fertilization (IVF) using eggs collected from eight superovulated C57BL/6N female mice and sperm collected from one C57BL/6N male (Charles River Laboratories). The ABE and BE4 mRNAs (50 ng/ul) were separately microinjected with the sgRNA (20 ng/ul) into the cytoplasm of the IVF zygotes. After culturing overnight in M16 medium, those embryos reached 2-cell stage of development were implanted into oviducts of pseudopregnant foster mothers (Swiss Webster, NY). Mice born to the foster mothers were genotyped and subsequently analyzed by WGS.

Free full text: Click here

Lee H.K., Smith H.E., Liu C., Willi M, & Hennighausen L. (2020). Cytosine base editor 4 but not adenine base editor generates off-target mutations in mouse embryos. Communications Biology, 3, 19.

Publication 2020

pCMV-ABE7.10 mMESSAGE mMACHINE T7 kit

Adenines Born C57bl mice Cell Cytidines Cytoplasm Eggs Embryos Female Gene In vitro fertilization Male Mice Mothers Mrnas Oviducts Plasmid River Sperm Transcription Zygotes

Corresponding Organization : National Institute of Diabetes and Digestive and Kidney Diseases

Other organizations : National Heart Lung and Blood Institute

Top 5 similar protocols

Protocol cited in 1 other protocol

Variable analysis

independent variables

Wap-E1 sgRNA (GGCACAGTATGGGCCCTTCT)
PCMV-BE4 plasmid
PCMV-ABE7.10 plasmid
ABE mRNA
BE4 mRNA

dependent variables

Genotype of mice born to the foster mothers

control variables

Mouse zygotes produced by in vitro fertilization (IVF) using eggs collected from eight superovulated C57BL/6N female mice and sperm collected from one C57BL/6N male (Charles River Laboratories)
Embryos cultured overnight in M16 medium
Embryos implanted into oviducts of pseudopregnant foster mothers (Swiss Webster, NY)

Annotations

Based on most similar protocols

Etiam vel ipsum. Morbi facilisis vestibulum nisl. Praesent cursus laoreet felis. Integer adipiscing pretium orci. Nulla facilisi. Quisque posuere bibendum purus. Nulla quam mauris, cursus eget, convallis ac, molestie non, enim. Aliquam congue. Quisque sagittis nonummy sapien. Proin molestie sem vitae urna. Maecenas lorem.

As authors may omit details in methods from publication, our AI will look for missing critical information across the 5 most similar protocols.

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!