Transcriptomic Analysis of C. elegans lpd-3 Mutant

N2 wild type and lpd-3(ok2138) animals were maintained at 20 °C and washed down from NGM plates using M9 solution and subjected to RNA extraction using TissueDisruptor and the RNeasy Mini Kit from Qiagen. RNA preparations were used for qRT-PCR or RNAseq. For qRT-PCR, reverse transcription was performed by SuperScript III, and quantitative PCR was performed using LightCycler Real-Time PCR Instruments. Relative mRNA levels were calculated by ∆∆CT method and normalized to actin. Primers for qRT-PCR: act-3 (forward, tccatcatgaagtgcgacat; reverse, tagatcctccgatccagacg) and fat-7 (forward, tgcgttttacgtagctggaa; reverse, caccaacggctacaactgtg). RNAseq library preparation and data analysis were performed as previously described²⁸ . Three biological replicates were included for each treatment. The cleaned RNAseq reads were mapped to the genome sequence of C. elegans using hisat2^{66 (link)}. Abundance of genes was expressed as FPKM (Reads per kilobase per million mapped reads). Identification of differentially expressed genes was performed using the DESeq2 package^{67 (link)}.