Northern Blot Analysis of HEK293 Cells

Northern blot hybridizations were conducted with the NorthernMax™ Kit (AM1940, Ambion, Austin, TX, USA) as previously described [57 (link)]. In brief, 15 µg total RNA from HEK293 cells were separated on 5% Criterion™ TBE polyacrylamide gels (3450048, Bio-Rad, Hercules, CA, USA) and transferred to positively charged nylon membranes (AM10100, Ambion, Austin, TX, USA). Hybridization was performed with a 5′ P³²-labeled DNA oligonucleotide overnight at 42 °C (NB-R1: 5′ CCCACCATGAGTCCAATGATTGCACCTTTGTTTGAACCCACATCTTCTGCAAAGAACACC 3′). Membranes were washed at 42 °C according the manufacturer’s recommendations (see NorthernMax™ Kit (AM1940, Ambion, Austin, TX, USA) for details). For RNase R treatment, 15 µg total RNA were digested with 10 units of RNase R (RNR07250, Epicentre, Madison, WI, USA) for 1 h at 37 °C; RNAs were separated by gel electrophoresis and analyzed by Northern blot hybridization as described above.