Viral DNA/RNA Extraction and Amplification

The AxyPrep Body Fluid Viral DNA/RNA Miniprep Kit (Axygen, Hangzhou, China) was used to extract the viral DNA from the supernatant of the tissue homogenate following the manufacturer’s instructions. For clinical diagnosis, the partial UL6 gene was amplified in a 25 μL reaction mixture: 12.5 μL of 2 Taq Plus Master Mix II (Vazyme, Nanjing, China), 1 μL of each primer (DVEV-F: GAGCGTATTTAGTAGAAACTGC; DVEV-R: TGAATGTTGTGATTGTTC): (10 µM) [23 (link)], 9 μL of nuclease-free water, and 2 μL of template DNA. The target UL6 gene was amplified under the following conditions: initial denaturation at 95 °C for 5 min; 35 cycles of denaturation at 95 °C for 30 s; annealing at 53 °C for 30 s; and extension at 72 °C for 30 s. The final extension was performed for 10 min at 72 °C. The PCR products were analyzed on a 2% agarose gel at 120 V for 30 min. Specific fragment bands were extracted using the FastPure Gel DNA Extraction Mini Kit (Vazyme, Nanjing, China). The PCR products were subcloned into the pMD 18-T vector (Takara, Dalian, China) and sequenced using Sanger sequencing (Sangon Biotech, Guangzhou, China).