Quantifying tRNA Charging for Serine and Methionine

To determine tRNA charging of serine and methionine tRNAs, a tRNA deacylation and β-elimination treatment was performed as previously described (25 (link)). Briefly, total RNA was extracted from no treatment and SHX-treated flash frozen cells using the Quick RNA extraction kit (Zymo) following the standard protocol. The RNA was then DNase I (NEB) treated for two hrs using 2 units of DNase I per hour and was cleaned of residual DNase I with the RNA clean and concentrator-5 (Zymo). DNase-treated RNA was then divided into two equal aliquots; one of the aliquots was deacylated by treatment with 1 M Tris pH 9 at 37°C for 1 h, and then ethanol precipitated. Following deacylation, both aliquots were treated with sodium periodate and 1 M lysine to promote β-elimination of oxidized 3′ RNA ends, and then ethanol precipitated. Samples were then run on a 10% TBE 7 M urea denaturing polyacrylamide gel. RNA was transferred using a wet transfer apparatus (Hoefer TE62) onto a nylon membrane and UV crosslinked to the membrane using the automatic setting (UV Stratalinker 1800). Membranes were probed in Ultrahyb Oligo buffer (Ambion) with 5′-32P-labeled (tRNA^Ser) TCACGTGTCCGAATGGACAGTAGA or 5′-32P-labeled (tRNA^Met) ATGAGCCCGGCGGAATCTCCT and signal was detected on a Typhoon phosphoimager.