Amplification and Purification of P. abyssi rRNA Genes

P. abyssi 16S and 23S rRNA genes were amplified by PCR from P. abyssi genomic DNA, using the Long PCR Enzyme Mix (Thermo Fisher Scientific), and primers (Metabion) 16S-5′Fw (TAATACGACTCACTATAGGGCGTACTCCCTTAATTCCGGTTGATCC, T7 RNA polymerase promoter is underlined), 16S-3′Rv (GATAGGAGGTGATCGAGCCGTAG) and 23S-5′Fw (TAATACGACTCACTATAGGGCTAAGCCGCCCGGTG), 23S-3′Rv (ACAGGACCTCGGGCGAT), respectively. 23S rDNA synthesis reaction contained 4% DMSO, and the ratio of 5′ and 3′ primers was 1:4. 16S rDNA was further used as a template for PCR amplification of fragment 431–533 nt, 856–962 nt, 1320–1512 nt, 16S.5′, 16S.C, and 16.S3′ DNA, using High Fidelity PCR Enzyme Mix (Thermo Fisher Scientific), and primers 16SI Fw (TAATACGACTCACTATAGGGCTTTTCCGGAGTGTAAAAAGCTCC) and 16SI Rv (CCAATAATAGTGGCCACCACTCG); 16SII Fw (TAATACGACTCACTATAG GGGAGTACGGCCGCA) and 16SII Rv (CCCCCGGTGAGGTTCC); 16SIII Fw (TAATACGACTCACTATAGGGAGTACCCGCGCGTCATC) and 16S-3′Rv; 16S-5′Fw and 16SI Rv; 16SI Fw and 16SII Rv; 16SII Fw and 16S-3′Rv, respectively. The relevance of the PCR products was confirmed by sequencing. A linearized pUC18-based plasmid carried a recombinant sR47 gene (Nolivos et al. 2005 (link)). These DNA templates served for RNA production by in vitro transcription using a TranscriptAid T7 High Yield Transcription kit (Thermo Fisher Scientific); RNAs were column- (Zymo Research) or PAGE-purified.